Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLJM60-Tia1
(Plasmid #38243)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 38243 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLJM60
  • Backbone size w/o insert (bp) 7400
  • Total vector size (bp) 8600
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Tia1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1161
  • GenBank ID
  • Entrez Gene
    Tia1 (a.k.a. 2310050N03Rik, TIA-1, mTIA-1)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sal1 (not destroyed)
  • 3′ cloning site Not1 (not destroyed)
  • 5′ sequencing primer ATGGAGGACGAGATGCCCAAGACTC
  • 3′ sequencing primer TCACTGGGTTTCATACCCGGCCACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene's lab and other requesting scientists have found this plasmid is quite difficult to prep. We recommend using long growing times and low copy protocols.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM60-Tia1 was a gift from David Sabatini (Addgene plasmid # 38243 ; http://n2t.net/addgene:38243 ; RRID:Addgene_38243)
  • For your References section:

    A unifying model for mTORC1-mediated regulation of mRNA translation. Thoreen CC, Chantranupong L, Keys HR, Wang T, Gray NS, Sabatini DM. Nature. 2012 May 2;485(7396):109-13. doi: 10.1038/nature11083. 10.1038/nature11083 PubMed 22552098