-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 38247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC
-
Backbone manufacturerhomemade
- Backbone size w/o insert (bp) 2944
- Total vector size (bp) 2944
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameVP16/PYL1
-
SpeciesA. thaliana (mustard weed)
- Promoter SV40p
-
Tags
/ Fusion Proteins
- VP16 (N terminal on insert)
- HA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site Spe1 (not destroyed)
- 3′ cloning site EcoR1 (not destroyed)
- 5′ sequencing primer GTGAGCGGATAACAATTTCAC
- 3′ sequencing primer CCC TCA CAT TGC CAA AAG AC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameGal4DBD/ABI*
-
SpeciesA. thaliana (mustard weed)
-
MutationD143A
- Promoter SV40 (IRES)
-
Tags
/ Fusion Proteins
- Gal4DBD (N terminal on insert)
- Flag (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site Sac1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer GCACATGCTTTACATGTGTTTAG
- 3′ sequencing primer gtg agc gga taa caa ttt cac (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are minor sequence discrepancies between depositor's reference sequence and Addgene's quality control sequence. These changes are in backbone region only and should not affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SV-ABAactDA was a gift from Jerry Crabtree (Addgene plasmid # 38247 ; http://n2t.net/addgene:38247 ; RRID:Addgene_38247) -
For your References section:
Engineering the ABA plant stress pathway for regulation of induced proximity. Liang FS, Ho WQ, Crabtree GR. Sci Signal. 2011 Mar 15;4(164):rs2. 10.1126/scisignal.2001449 PubMed 21406691