Skip to main content

pMXs-IP Su9-GFP
(Plasmid #38250)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38250 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pMXs-IP
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 6800
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Su9
  • Alt name
    subunit9 of mitochondrial ATPase
  • Species
    N. crassa
  • Insert Size (bp)
    206
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer actagaattcatggcctccactcgtgtcc
  • 3′ sequencing primer tcatggatccgaagagtaggcgcgcttc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr.Katsuyoshi Mihara (Kyushu University)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-IP Su9-GFP was a gift from Noboru Mizushima (Addgene plasmid # 38250)
  • For your References section:

    Parkin mediates proteasome-dependent protein degradation and rupture of the outer mitochondrial membrane. Yoshii SR, Kishi C, Ishihara N, Mizushima N. J Biol Chem. 2011 Jun 3;286(22):19630-40. Epub 2011 Mar 18. 10.1074/jbc.M110.209338 PubMed 21454557