Skip to main content

pMXs-IP spGFP-ERGIC53
(Plasmid #38270)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 38270 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMXs-IP
  • Backbone manufacturer
    Dr. Toshio Kitamura of the University of Tokyo
  • Backbone size w/o insert (bp) 5800
  • Total vector size (bp) 6800
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ERGIC-53
  • Alt name
    ER-Golgi intermediate compartment 53 kDa protein
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1500
  • Mutation
    deleted signal peptide (1-30 amino acids)
  • GenBank ID
    U09716
  • Entrez Gene
    LMAN1 (a.k.a. ERGIC-53, ERGIC53, F5F8D, FMFD1, MCFD1, MR60, gp58)
  • Tag / Fusion Protein
    • EGFP with Calreticulin signal peptide at N-terminal (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer GAGGAACTGCTTCCTTCACG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ORFeome Collaboration clone, on13634
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMXs-IP spGFP-ERGIC53 was a gift from Noboru Mizushima (Addgene plasmid # 38270 ; http://n2t.net/addgene:38270 ; RRID:Addgene_38270)
  • For your References section:

    Characterization of autophagosome formation site by a hierarchical analysis of mammalian Atg proteins. Itakura E, Mizushima N. Autophagy. 2010 Aug;6(6):764-76. 10.4161/auto.6.6.12709 PubMed 20639694