p2Bac.XPC
(Plasmid #39204)

• Depositing Lab: Aziz Sancar
• Publication: Reardon et al J Biol Chem. 1996 Aug 9;271(32):19451-6.

Backbone

• Vector backbone: p2Bac
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 7100
• Total vector size (bp): 10700
• Vector type: Insect Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: XPC
• Alt name: xeroderma pigmentosum, complementation group C
• Alt name: XP3
• Alt name: RAD4
• Species: H. sapiens (human)
• Insert Size (bp): 3600
• Mutation: Q475K polymorphism
• GenBank ID: NM_004628.4
• Entrez Gene: XPC (a.k.a. RAD4, XP3, XPCC, p125)
• Promoter: Pp10

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NotI (unknown if destroyed)
• 3′ cloning site: NotI (unknown if destroyed)
• 5′ sequencing primer: p2Bac-F (ggacctttaattcaacccaacac)
• 3′ sequencing primer: BGH_rev

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry