Skip to main content

pRAJ22m
(Plasmid #39252)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39252 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSTC0
  • Backbone manufacturer
    Jaramillo Lab
  • Backbone size w/o insert (bp) 4042
  • Total vector size (bp) 4164
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RAJ22 system (no transRNA)
  • Promoter pLlacO-1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer attaccgcctttgagtgagc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    http://partsregistry.org/Part:pSB1AK3

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRAJ22m was a gift from Alfonso Jaramillo (Addgene plasmid # 39252 ; http://n2t.net/addgene:39252 ; RRID:Addgene_39252)
  • For your References section:

    De novo automated design of small RNA circuits for engineering synthetic riboregulation in living cells. Rodrigo G, Landrain TE, Jaramillo A. Proc Natl Acad Sci U S A. 2012 Sep 18;109(38):15271-6. Epub 2012 Sep 4. 10.1073/pnas.1203831109 PubMed 22949707