Skip to main content

pPac-PL-mCD8-D2A-Gal4
(Plasmid #39457)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 39457 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pPac-PL
  • Backbone size w/o insert (bp) 6392
  • Total vector size (bp) 9777

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCD8-D2A-Gal4
  • Promoter actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site none (destroyed during cloning)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer AGTCGTCTAATCCAGAGACC
  • 3′ sequencing primer GATCTTGATCTTCATGGTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPac-PL-mCD8-D2A-Gal4 was a gift from Benjamin White (Addgene plasmid # 39457 ; http://n2t.net/addgene:39457 ; RRID:Addgene_39457)
  • For your References section:

    A novel approach for directing transgene expression in Drosophila: T2A-Gal4 in-frame fusion. Diao F, White BH. Genetics. 2012 Mar;190(3):1139-44. Epub 2011 Dec 29. 10.1534/genetics.111.136291 PubMed 22209908