pPac-PL-mCD8-D2A-Gal4
(Plasmid
#39457)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 39457 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepPac-PL
- Backbone size w/o insert (bp) 6392
- Total vector size (bp) 9777
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemCD8-D2A-Gal4
- Promoter actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site none (destroyed during cloning)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer AGTCGTCTAATCCAGAGACC
- 3′ sequencing primer GATCTTGATCTTCATGGTCG
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPac-PL-mCD8-D2A-Gal4 was a gift from Benjamin White (Addgene plasmid # 39457 ; http://n2t.net/addgene:39457 ; RRID:Addgene_39457) -
For your References section:
A novel approach for directing transgene expression in Drosophila: T2A-Gal4 in-frame fusion. Diao F, White BH. Genetics. 2012 Mar;190(3):1139-44. Epub 2011 Dec 29. 10.1534/genetics.111.136291 PubMed 22209908