Skip to main content
Addgene

pLKO.1-puro shSlp4-a #2
(Plasmid #40070)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40070 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-puro
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 7060
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Slp4-a shRNA-2
  • gRNA/shRNA sequence
    (AA)TCCCCACTACAACCATACA
  • Species
    Canis lupus familiaris (dog)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site BamHI (destroyed during cloning)
  • 5′ sequencing primer GACTATCATATGCTTACCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro shSlp4-a #2 was a gift from Fernando Martin-Belmonte (Addgene plasmid # 40070 ; http://n2t.net/addgene:40070 ; RRID:Addgene_40070)
  • For your References section:

    Synaptotagmin-like proteins control the formation of a single apical membrane domain in epithelial cells. Galvez-Santisteban M, Rodriguez-Fraticelli AE, Bryant DM, Vergarajauregui S, Yasuda T, Banon-Rodriguez I, Bernascone I, Datta A, Spivak N, Young K, Slim CL, Brakeman PR, Fukuda M, Mostov KE, Martin-Belmonte F. Nat Cell Biol. 2012 Jul 22. doi: 10.1038/ncb2541. 10.1038/ncb2541 PubMed 22820376