-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40116 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepDONR201
-
Backbone manufacturerInvitrogen
- Backbone size (bp) 4470
-
Modifications to backboneThe following have been added to the Gateway donor vector by Gateway cloning: Dendra2 PAFP, TEV protease cleavage site, S-epitope,
-
Vector typeGateway Donor vector
-
Tags
/ Fusion Proteins
- Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted) (N terminal on backbone)
- TEV protease cleavage site (N terminal on backbone)
- S-peptide (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer T1ter-rev (AAACGAAAGGCCCAGTCTTC)
- 3′ sequencing primer Kan-R (ATCGCGAGCCCATTTATACC) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This vector can be used to make Dendra2 PAFP N-terminal fusions by multi-site Gateway reaction.
Alternate plasmid name: pDONR 201 + Dendra2 (TEV/Spep)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEG545 was a gift from Geraldine Seydoux (Addgene plasmid # 40116 ; http://n2t.net/addgene:40116 ; RRID:Addgene_40116) -
For your References section:
Regulation of the MEX-5 gradient by a spatially segregated kinase/phosphatase cycle. Griffin EE, Odde DJ, Seydoux G. Cell. 2011 Sep 16;146(6):955-68. 10.1016/j.cell.2011.08.012 PubMed 21925318