pEG593
(Plasmid
#40119)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40119 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCG150
-
Backbone manufacturerAddgene plasmid 17247
- Backbone size w/o insert (bp) 6351
-
Modifications to backboneSee comment below
-
Vector typeWorm Expression ; Gateway Destination vector
-
Selectable markersunc-119 rescuing fragment
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMex-5 (ATG through 648 bp of 3'UTR) R274E K318E (RNAi res)
-
Alt nameMex-5
-
SpeciesC. elegans (nematode)
-
MutationR274E, K318E, Exon 2 recoded to be RNAi-resistant
-
GenBank IDNM_070165.4 NP_502566.1
-
Entrez Genemex-5 (a.k.a. CELE_W02A2.7)
- Promoter 4.4 kb mex-5 promoter fragment
-
Tags
/ Fusion Proteins
- Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted) (N terminal on backbone)
- TEV protease cleavage site (N terminal on backbone)
- S-peptide (N terminal on backbone)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer DENDRA-F (GGGAACCATCGACTGAAAAA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Dendra::MEX-5 constructs were constructed as follows. A 4.4 kb mex-5 promoter fragment based on Tenlen et al. (2008) was cloned into pDONRP4P1R (Invitrogen). Dendra2/TEV/S-peptide (Gallo et al., 2010) was cloned into pDONR201. A MEX-5 genomic fragment from the start ATG through 648 bp of 3'UTR was cloned into pDONRP2RP3. Exon 2 of mex-5 was recoded to be RNAi-resistant (Gen-Script) so as to allow depletion of endogenous MEX-5/6 without depletion of the transgene. These constructs were assembled into pCG150 using three-way Gateway system (LR reaction) (Invitrogen) (Merritt et al., 2008). Mutations were made by recombinant PCR and all inserts were sequenced verified.
Alternate plasmid name: pCG150 + 4.4kb+Dendra+ gen MEX-5 R274E K318E (RNAi res) +3’UTR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEG593 was a gift from Geraldine Seydoux (Addgene plasmid # 40119 ; http://n2t.net/addgene:40119 ; RRID:Addgene_40119) -
For your References section:
Regulation of the MEX-5 gradient by a spatially segregated kinase/phosphatase cycle. Griffin EE, Odde DJ, Seydoux G. Cell. 2011 Sep 16;146(6):955-68. 10.1016/j.cell.2011.08.012 PubMed 21925318