pEG476
(Plasmid
#40198)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 40198 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepIC26
-
Backbone manufacturerCheeseman lab
- Backbone size w/o insert (bp) 16397
-
Modifications to backboneGFP replaced with Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted)
-
Vector typeWorm Expression
-
Selectable markersunc-119
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMex-5 (S404A)
-
Alt nameMex-5
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1407
-
MutationS404A
-
GenBank IDNM_070165.4 NP_502566.1
-
Entrez Genemex-5 (a.k.a. CELE_W02A2.7)
- Promoter pie-1
-
Tags
/ Fusion Proteins
- Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted) (N terminal on backbone)
- TEV protease cleavage site (N terminal on backbone)
- S-peptide (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer DENDRA-F (GGGAACCATCGACTGAAAAA) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
MEX-5 transgenes driven by the pie-1 promoter and pie-1 3'UTR were constructed by cloning the mex-5 cDNA as a SpeI fragment downstream of a Dendra2/TEV/S-peptide tag cloned into pIC26 LAP tag (Cheeseman et al., 2004).
Alternate plasmid name: pie-1 prom – Dendra2/TEV/Speptide/MEX-5(S404A) - pie-1 3'UTR
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEG476 was a gift from Geraldine Seydoux (Addgene plasmid # 40198 ; http://n2t.net/addgene:40198 ; RRID:Addgene_40198) -
For your References section:
Regulation of the MEX-5 gradient by a spatially segregated kinase/phosphatase cycle. Griffin EE, Odde DJ, Seydoux G. Cell. 2011 Sep 16;146(6):955-68. 10.1016/j.cell.2011.08.012 PubMed 21925318