Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEG476
(Plasmid #40198)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 40198 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pIC26
  • Backbone manufacturer
    Cheeseman lab
  • Backbone size w/o insert (bp) 16397
  • Modifications to backbone
    GFP replaced with Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted)
  • Vector type
    Worm Expression
  • Selectable markers
    unc-119

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Mex-5 (S404A)
  • Alt name
    Mex-5
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    1407
  • Mutation
    S404A
  • GenBank ID
    NM_070165.4 NP_502566.1
  • Entrez Gene
    mex-5 (a.k.a. CELE_W02A2.7)
  • Promoter pie-1
  • Tags / Fusion Proteins
    • Dendra2 PAFP (sequence optimized for worm expression; three synthetic introns inserted) (N terminal on backbone)
    • TEV protease cleavage site (N terminal on backbone)
    • S-peptide (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer DENDRA-F (GGGAACCATCGACTGAAAAA)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

MEX-5 transgenes driven by the pie-1 promoter and pie-1 3'UTR were constructed by cloning the mex-5 cDNA as a SpeI fragment downstream of a Dendra2/TEV/S-peptide tag cloned into pIC26 LAP tag (Cheeseman et al., 2004).

Alternate plasmid name: pie-1 prom – Dendra2/TEV/Speptide/MEX-5(S404A) - pie-1 3'UTR

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEG476 was a gift from Geraldine Seydoux (Addgene plasmid # 40198 ; http://n2t.net/addgene:40198 ; RRID:Addgene_40198)
  • For your References section:

    Regulation of the MEX-5 gradient by a spatially segregated kinase/phosphatase cycle. Griffin EE, Odde DJ, Seydoux G. Cell. 2011 Sep 16;146(6):955-68. 10.1016/j.cell.2011.08.012 PubMed 21925318