Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #40235)


Item Catalog # Description Quantity Price (USD)
Plasmid 40235 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5667
  • Total vector size (bp) 6381
  • Vector type
    Bacterial Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
    yeast Enhanced Green Fluorescent Protein
  • Insert Size (bp)
  • Promoter GAL1
  • Tag / Fusion Protein
    • HIS3MX6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site SmaI (not destroyed)
  • 5′ sequencing primer caagactggaccatcaccaa
  • 3′ sequencing primer ccctccgaaggaagactctc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Mumberg D, Muller R and Funk M. 1995. Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene 156(1): 119-122. Sheff MA and Thorn KS (2004). Optimized cassettes for fluorescent protein tagging in Saccharomyces cerevisiae. Yeast 21(8): 661-670.
  • Terms and Licenses
  • Articles Citing this Plasmid

Depositor Comments

yEGFP contains a M233I point mutation. Depositor states that this mutation does not affect yEGFP function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS413-GAL1-yEGFP1 was a gift from Michael Benton (Addgene plasmid # 40235 ; ; RRID:Addgene_40235)