Skip to main content

pRS-45
(Plasmid #40586)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40586 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET16b
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 5632
  • Total vector size (bp) 6504
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    yTAND12-TEV-hTBPc
  • Alt name
    Transcription initiation factor TFIID subunit 1
  • Alt name
    TATA-box-binding protein
  • Alt name
    TBP
  • Species
    H. sapiens (human), S. cerevisiae (budding yeast)
  • Insert Size (bp)
    872
  • GenBank ID
    NP_011790 NP_003185
  • Entrez Gene
    TAF1 (a.k.a. YGR274C, KAT4, TAF130, TAF145)
  • Entrez Gene
    TBP (a.k.a. GTF2D, GTF2D1, HDL4, SCA17, TBP1, TFIID)
  • Promoter T7
  • Tags / Fusion Proteins
    • His-tag (N terminal on insert)
    • yTAND12 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GGGTTATGCTAGTTATTGCTCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS-45 was a gift from Harald Schwalbe (Addgene plasmid # 40586 ; http://n2t.net/addgene:40586 ; RRID:Addgene_40586)
  • For your References section:

    Recombinant expression and purification of human TATA binding protein using a chimeric fusion. Silvers R, Saxena K, Kudlinzki D, Schwalbe H. Protein Expr Purif. 2012 Jul 24;85(1):142-147. 10.1016/j.pep.2012.07.006 PubMed 22841618