mutpRL-TK 3xUTR
(Plasmid #40758)

• Purpose: To evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNA
• Depositing Lab: Phillip Zamore
• Depositing Organization: University of Massachusetts, Worcester
  Located in United States of America
• Publication: Broderick et al RNA. 2011 Oct;17(10):1858-69. Epub 2011 Aug 30.

Backbone

• Vector backbone: mutpRL-TK
• Backbone manufacturer: Sharp Lab (http://web.mit.edu/sharplab/RNAi/Cloning.html)
• Modifications to backbone: pRL-TK (Promega) was digested with XbaI, and the following ligated in: ctagattccgagatatcggtaatgggcc This produced a modified vector, still containing an XbaI site, but now also containing an ApaI site, to allow for directional cloning of 3' UTR inserts. Final vector: TAATTctagattccgagatatcggtaatgggccCTAGA
• Vector type: Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Top10
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3 copies of the CXCR4 small RNA target site
• Mutation: mutated from TAG to CTC at nt 387–389 of the Renilla luciferase open reading frame to generate mismatches with seed positions 5, 6, and 7 of the siRNA guide strand by PCR-directed mutagenesis
• Promoter: TK
• Tag / Fusion Protein:
  • luciferase (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: ApaI (not destroyed)
• 5′ sequencing primer: CCAATGCTATTGTTGAAGGTGCCAAG
• 3′ sequencing primer: CACTGCATTCTAGTTGTGGTTTGTCC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 40758-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 40758-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Renilla Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.