Skip to main content

pAS-2 (mm21)
(Plasmid #40837)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 40837 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR/D-EGFP
  • Backbone manufacturer
    Zamore lab
  • Total vector size (bp) 3549
  • Modifications to backbone
    A DNA fragment encoding EGFP together with the downstream multiple cloning site was amplified from pEGFP-N1 (Clontech, Mountain View, CA, USA) and inserted into pENTR/D-TOPO (Invitrogen, Carlsbad, CA, USA) using the pENTR Directional TOPO Cloning Kit (Invitrogen) to generate pENTR/D-EGFP.
  • Vector type
    Insect Expression ; miRNA reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    let-7–mm21
  • Species
    D. melanogaster (fly)
  • Promoter Actin5C
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The let-7 mm21 complimentary sequence was inserted in the XbaI site in the 3'UTR of EGFP using the following oligos:
s: CTAGATCTATACAACCTACTACCTCAT
as: CTAGATGAGGTAGTAGGTTGTATAGAT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAS-2 (mm21) was a gift from Phillip Zamore (Addgene plasmid # 40837 ; http://n2t.net/addgene:40837 ; RRID:Addgene_40837)
  • For your References section:

    Target RNA-directed trimming and tailing of small silencing RNAs. Ameres SL, Horwich MD, Hung JH, Xu J, Ghildiyal M, Weng Z, Zamore PD. Science. 2010 Jun 18;328(5985):1534-9. 10.1126/science.1187058 PubMed 20558712