-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 41035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDNA4
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5030
- Total vector size (bp) 9401
-
Vector typeMammalian Expression
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameB domain deleted FVIII
-
Alt nameBDD-FVIII
-
SpeciesH. sapiens (human)
-
Insert Size (bp)4374
-
MutationB domain deletion
-
GenBank IDNM_000132
-
Entrez GeneF8 (a.k.a. AHF, DXS1253E, F8B, F8C, FVIII, HEMA, THPH13)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsiWI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ATAGGGAGACCCAAGCTGGC
- 3′ sequencing primer CGAATGGGTGACCTCGAGCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA4/BDD-FVIII was a gift from Robert Peters (Addgene plasmid # 41035 ; http://n2t.net/addgene:41035 ; RRID:Addgene_41035) -
For your References section:
Biochemical and functional characterization of a recombinant monomeric Factor VIII-Fc fusion protein. Peters RT, Toby G, Lu Q, Liu T, Kulman JD, Low SC, Bitonti AJ, Pierce GF. J Thromb Haemost. 2012 Dec 4. doi: 10.1111/jth.12076. 10.1111/jth.12076 PubMed 23205847