Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDNA4/BDD-FVIII
(Plasmid #41035)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 41035 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCDNA4
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5030
  • Total vector size (bp) 9401
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    B domain deleted FVIII
  • Alt name
    BDD-FVIII
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4374
  • Mutation
    B domain deletion
  • GenBank ID
    NM_000132
  • Entrez Gene
    F8 (a.k.a. AHF, DXS1253E, F8B, F8C, FVIII, HEMA, THPH13)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsiWI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ATAGGGAGACCCAAGCTGGC
  • 3′ sequencing primer CGAATGGGTGACCTCGAGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDNA4/BDD-FVIII was a gift from Robert Peters (Addgene plasmid # 41035 ; http://n2t.net/addgene:41035 ; RRID:Addgene_41035)
  • For your References section:

    Biochemical and functional characterization of a recombinant monomeric Factor VIII-Fc fusion protein. Peters RT, Toby G, Lu Q, Liu T, Kulman JD, Low SC, Bitonti AJ, Pierce GF. J Thromb Haemost. 2012 Dec 4. doi: 10.1111/jth.12076. 10.1111/jth.12076 PubMed 23205847