pCMV-HA.Tetherin
(Plasmid #41068)

• Depositing Lab: Paul Spearman
• Publication: Ali et al PLoS One. 2010 Feb 2;5(2):e9005.

Backbone

• Vector backbone: pCMV-HA
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 3800
• Total vector size (bp): 4350
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Tetherin
• Alt name: BST-2
• Alt name: bone marrow stromal cell antigen 2
• Alt name: CD317
• Species: H. sapiens (human)
• Insert Size (bp): 550
• GenBank ID: NM_004335.2 NP_004326.1
• Entrez Gene: BST2 (a.k.a. CD317, HM1.24, TETHERIN)
• Promoter: CMV
• Tag / Fusion Protein:
  • HA (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: CMV-F, LNCX
• 3′ sequencing primer: SV40pA-R

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Plasmid pCR2.1/tetherin (template for Tetherin gene) provided by Paul Bieniasz.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid was generated by PCR cloning of the tetherin cDNA into backbone plasmid pCMV-HA (Clontech). The tetherin gene was amplified from a source provided by Paul Bieniasz (pCR2.1/tetherin) using the following primers:

1) SalTetherin-f (ACGCGTCGACCATGGCATCTACTTCGTATGAC)
2) XhoTetherin-r (CCGCTCGAGTCACTGCAGCAGAGCGCTGAG)

The 550 bp fragment was amplified, digested, and cloned into pCMV-HA using SalI and XhoI sites. The sequence was verified by sequencing throughout the amplified fragement, and shown to express HA-tetherin protein by Western blot.