-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGFP-N1
-
Backbone manufacturerClontech
- Total vector size (bp) 5015
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCytochrome C
-
Alt namecytog
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)330
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (destroyed during cloning)
- 3′ cloning site BglII (destroyed during cloning)
- 5′ sequencing primer acgtgtcgacctaatatgggtgatgttgaaaaagg
- 3′ sequencing primer acagatctttctcattagtagcctttttaag
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCytochrome C-GFP was a gift from Douglas Green (Addgene plasmid # 41182 ; http://n2t.net/addgene:41182 ; RRID:Addgene_41182) -
For your References section:
The coordinate release of cytochrome c during apoptosis is rapid, complete and kinetically invariant. Goldstein JC, Waterhouse NJ, Juin P, Evan GI, Green DR. Nat Cell Biol. 2000 Mar;2(3):156-62. 10.1038/35004029 PubMed 10707086