-
Purpose(Empty Backbone) Inducible lentiviral expression, TRE-gateway-HA; PGK-rtTA-2A-puro
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41394 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerAddgene plasmid 41393
- Backbone size (bp) 9394
-
Vector typeMammalian Expression, Lentiviral ; Gateway Destination vector, Doxycycline inducible
- Promoter TRE promoter, Tet ON
-
Selectable markersPuromycin
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberUnknown
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer LNCX
- 3′ sequencing primer O.PGK1b-R (GAACGGACGTGAAGAATGTG)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The plasmid expresses rtTA-VP16-2A-puro from the PGK promoter, so it can be used as an 'all-in-one' dox on system.
Alternate plasid name:
TRE-gateway-HA; PGK-rtTA-2A-puro
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLIX_402 was a gift from David Root (Addgene plasmid # 41394)