Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #41517)


Item Catalog # Description Quantity Price (USD)
Plasmid 41517 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 2638
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Polylinker flanked by 2 Mva1269I cut sites
  • Species
  • Insert Size (bp)
  • Promoter SV40

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ASK-FN2 (CGGCCTTTTTACGGTTCCTG)
  • 3′ sequencing primer pBABE_3
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    TAL-BBL1-ID43 was a gift from Veit Hornung (Addgene plasmid # 41517 ; ; RRID:Addgene_41517)
  • For your References section:

    A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes. Schmid-Burgk JL, Schmidt T, Kaiser V, Honing K, Hornung V. Nat Biotechnol. 2012 Dec 16. doi: 10.1038/nbt.2460. 10.1038/nbt.2460 PubMed 23242165