pMALp2x-CARP-1
(Plasmid #41727)

• Depositing Lab: Koji Okamoto
• Publication: Nakano et al Proc Natl Acad Sci U S A. 2006 Sep 12;103(37):13652-7. Epub 2006 Aug 31.

Backbone

• Vector backbone: pMAL-p2x
• Backbone manufacturer: New England Biolabs
• Backbone size w/o insert (bp): 6695
• Total vector size (bp): 7484
• Vector type: Bacterial Subcloning

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): JM109
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: clam ADP-ribosylating protein-1
• Alt name: CARP-1
• Alt name: NAD+:DNA(guanine-N2)-ADP-D-ribosyltransferase
• Species: Meretrix lamarckii
• Insert Size (bp): 789
• Mutation: deleted 5'-UTR nucleotides 1-64
• GenBank ID: AB266110
• Promoter: pMB1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: gtaaaacgacggccag
• 3′ sequencing primer: ggtcgtcagactgtcgatgaagcc

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A CARP-1 coding sequence is inserted in "an opposite direction" to the tac promoter of the vector, due to the toxicity to Escherichia coli. This plasmid is for subcloning,; not for expression.