Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #41742)


Item Catalog # Description Quantity Price (USD)
Plasmid 41742 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5000
  • Modifications to backbone
    Kozak Consensus Sequence added
  • Vector type
    Mammalian Expression, Bacterial Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Halotag 2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Alternate plasmid name: pCDNA5-KGH2

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-EGFP-HaloTag2 was a gift from Craig Crews (Addgene plasmid # 41742 ; ; RRID:Addgene_41742)
  • For your References section:

    Small-molecule hydrophobic tagging-induced degradation of HaloTag fusion proteins. Neklesa TK, Tae HS, Schneekloth AR, Stulberg MJ, Corson TW, Sundberg TB, Raina K, Holley SA, Crews CM. Nat Chem Biol. 2011 Jul 3;7(8):538-43. doi: 10.1038/nchembio.597. 10.1038/nchembio.597 PubMed 21725302