MSCV-PM BRD7 sh2
(Plasmid
#41928)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 41928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneMSCV
- Backbone size w/o insert (bp) 7556
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRD7
-
Alt nameENSG00000166164
-
gRNA/shRNA sequenceTTTCATGGTACTAAAATCCATT
-
SpeciesH. sapiens (human)
-
Entrez GeneBRD7 (a.k.a. BP75, CELTIX1, NAG4)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer pLXSN-5
- 3′ sequencing primer MSCV-rev
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
MSCV-PM BRD7 sh2 was a gift from Stephen Elledge (Addgene plasmid # 41928 ; http://n2t.net/addgene:41928 ; RRID:Addgene_41928) -
For your References section:
Polybromo-associated BRG1-associated factor components BRD7 and BAF180 are critical regulators of p53 required for induction of replicative senescence. Burrows AE, Smogorzewska A, Elledge SJ. Proc Natl Acad Sci U S A. 2010 Aug 10;107(32):14280-5. doi: 10.1073/pnas.1009559107. Epub 2010 Jul 26. 10.1073/pnas.1009559107 PubMed 20660729