-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42022 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5338
- Total vector size (bp) 11281
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTNRC6B
-
SpeciesH. sapiens (human)
-
GenBank IDNP_055903
-
Entrez GeneTNRC6B (a.k.a. GDSBA)
- Promoter CMV
-
Tags
/ Fusion Proteins
- Myc (N terminal on insert)
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmyc-GFP-TNRC6B was a gift from Kumiko Ui-Tei (Addgene plasmid # 42022 ; http://n2t.net/addgene:42022 ; RRID:Addgene_42022) -
For your References section:
Human TNRC6A is an Argonaute-navigator protein for microRNA-mediated gene silencing in the nucleus. Nishi K, Nishi A, Nagasawa T, Ui-Tei K. RNA. 2013 Jan;19(1):17-35. doi: 10.1261/rna.034769.112. Epub 2012 Nov 13. 10.1261/rna.034769.112 PubMed 23150874