psiCHECK-640a-2
              
              
                (Plasmid
                
                #42093)
              
            
            
            
          - 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42093 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepsiCHECK-1
- 
              Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3544
- Total vector size (bp) 3567
- 
              Vector typeMammalian Expression, Luciferase
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameZEB1
- 
                    SpeciesH. sapiens (human)
- 
                  Insert Size (bp)23
- 
                  Mutationcontains the 1635-1657 nt segment of ZEB1 mRNA (NM_030751.4)
- 
                    GenBank IDNM_030751.4
- 
                        Entrez GeneZEB1 (a.k.a. AREB6, BZP, DELTAEF1, FECD6, NIL2A, PPCD3, TCF8, ZFHEP, ZFHX1A)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (destroyed during cloning)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer CGCAACTACAACGCCTACCT (Common Sequencing Primers)
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: psiCHECK-640a-2 was a gift from Kumiko Ui-Tei (Addgene plasmid # 42093 ; http://n2t.net/addgene:42093 ; RRID:Addgene_42093)
- 
                For your References section: E-cadherin is transcriptionally activated via suppression of ZEB1 transcriptional repressor by small RNA-mediated gene silencing. Mazda M, Nishi K, Naito Y, Ui-Tei K. PLoS One. 2011;6(12):e28688. doi: 10.1371/journal.pone.0028688. Epub 2011 Dec 21. 10.1371/journal.pone.0028688 PubMed 22205962
