-
PurposeExpresses GI-ZFP2 for light-inducible activation of gene expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5334
- Total vector size (bp) 9276
-
Modifications to backboneZFP2 was inserted into the GI-ZFP1 plasmid using the NotI and XbaI sites to create the GI-FLAG-ZFP2 gene. The FLAG tag was then inserted using the NotI site.
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGIGANTEA-FLAG-ZFP2
-
Alt nameGI-FLAG-ZFP2
-
Alt nameGI-ZFP2
-
Alt nameGI
-
SpeciesA. thaliana (mustard weed), Synthetic
-
Insert Size (bp)3942
-
Entrez GeneGI (a.k.a. AT1G22770, FB, GIGANTEA, T22J18.6, T22J18_6)
- Promoter CMV
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ATTGACGCAAATGGGCGGTAGGCGTGT
- 3′ sequencing primer GCC TGC TAT TGT CTT CCC AAT
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-GI-ZFP2 was a gift from Charles Gersbach (Addgene plasmid # 42215 ; http://n2t.net/addgene:42215 ; RRID:Addgene_42215) -
For your References section:
Light-inducible spatiotemporal control of gene activation by customizable zinc finger transcription factors. Polstein LR, Gersbach CA. J Am Chem Soc. 2012 Oct 10;134(40):16480-3. doi: 10.1021/ja3065667. Epub 2012 Sep 27. 10.1021/ja3065667 PubMed 22963237