KaiC CII cat-/EE (E318Q; S431E; T432E)
(Plasmid
#42498)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 42498 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneprset-b
-
Backbone manufacturerinvitrogen
- Backbone size w/o insert (bp) 2200
- Total vector size (bp) 4468
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsGrowth instructions for expression: grow TB culture for 2 days at 25C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKaiC CII cat-/EE (E318Q; S431E; T432E)
-
Speciescyanobacteria
-
Insert Size (bp)1500
-
MutationE318Q; S431E; T432E
-
GenBank IDCP000100
- Promoter t7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CGATAAGGATCCGGGACTGGAAGTTCTGTTCCAGGGGCCCATGACTTCCGCTGAGATGACTAGCC
- 3′ sequencing primer GGAGGTAGATCTTTAGCTCTCCGGCCCTTTTTCTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
KaiC CII cat-/EE (E318Q; S431E; T432E) was a gift from Michael Rust (Addgene plasmid # 42498 ; http://n2t.net/addgene:42498 ; RRID:Addgene_42498) -
For your References section:
Robust and tunable circadian rhythms from differentially sensitive catalytic domains. Phong C, Markson JS, Wilhoite CM, Rust MJ. Proc Natl Acad Sci U S A. 2013 Jan 15;110(3):1124-9. doi: 10.1073/pnas.1212113110. Epub 2012 Dec 31. 10.1073/pnas.1212113110 PubMed 23277568