pMCSG49-AlleyCat7
(Plasmid
#42591)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42591 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMCSG49
-
Backbone manufacturerMidwest Center for Structural Genomics
- Backbone size w/o insert (bp) 4278
- Total vector size (bp) 4511
-
Modifications to backbonedeletion of Asparagine (AAT) at the unique SspI site (AATATT) and insertion of AAGGGTGATCCGGC after stop codon of the gene
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth TemperatureRoom Temperature
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemutated C-terminal portion of calmodulin gene (M76-K148)
-
SpeciesG. gallus (chicken)
-
Insert Size (bp)222
-
Mutationchanged Phenylalanine 92 to Glutamine acid, Isoleucine 85 to Leucine, Alanine 88 to Glutamine, Histidine 107 to Isoleucine, Leucine 112 to Arginine, Methionine 124 to Leucine, Alanine 128 to Threonine, Methionine 144 to Arginine
- Promoter T7
-
Tags
/ Fusion Proteins
- TEV (N terminal on insert)
- His (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CCTGTACTTCCAATCCATGAAAGATACAGATAGC
- 3′ sequencing primer TTATCCACTTCCAATGCCGGATCACCCTTTCAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that numbering for mutations starts with Ala (the second amino acid) immediately after the starting Met.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMCSG49-AlleyCat7 was a gift from Ivan Korendovych (Addgene plasmid # 42591 ; http://n2t.net/addgene:42591 ; RRID:Addgene_42591) -
For your References section:
A Single Mutation in a Regulatory Protein Produces Evolvable Allosterically Regulated Catalyst of Nonnatural Reaction. Moroz OV, Moroz YS, Wu Y, Olsen AB, Cheng H, Mack KL, McLaughlin JM, Raymond EA, Zhezherya K, Roder H, Korendovych IV. Angew Chem Int Ed Engl. 2013 Apr 29. doi: 10.1002/anie.201302339. 10.1002/anie.201302339 PubMed 23630096