Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMCSG49-AlleyCat7
(Plasmid #42591)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 42591 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMCSG49
  • Backbone manufacturer
    Midwest Center for Structural Genomics
  • Backbone size w/o insert (bp) 4278
  • Total vector size (bp) 4511
  • Modifications to backbone
    deletion of Asparagine (AAT) at the unique SspI site (AATATT) and insertion of AAGGGTGATCCGGC after stop codon of the gene
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    Room Temperature
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mutated C-terminal portion of calmodulin gene (M76-K148)
  • Species
    G. gallus (chicken)
  • Insert Size (bp)
    222
  • Mutation
    changed Phenylalanine 92 to Glutamine acid, Isoleucine 85 to Leucine, Alanine 88 to Glutamine, Histidine 107 to Isoleucine, Leucine 112 to Arginine, Methionine 124 to Leucine, Alanine 128 to Threonine, Methionine 144 to Arginine
  • Promoter T7
  • Tags / Fusion Proteins
    • TEV (N terminal on insert)
    • His (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CCTGTACTTCCAATCCATGAAAGATACAGATAGC
  • 3′ sequencing primer TTATCCACTTCCAATGCCGGATCACCCTTTCAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note that numbering for mutations starts with Ala (the second amino acid) immediately after the starting Met.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCSG49-AlleyCat7 was a gift from Ivan Korendovych (Addgene plasmid # 42591 ; http://n2t.net/addgene:42591 ; RRID:Addgene_42591)
  • For your References section:

    A Single Mutation in a Regulatory Protein Produces Evolvable Allosterically Regulated Catalyst of Nonnatural Reaction. Moroz OV, Moroz YS, Wu Y, Olsen AB, Cheng H, Mack KL, McLaughlin JM, Raymond EA, Zhezherya K, Roder H, Korendovych IV. Angew Chem Int Ed Engl. 2013 Apr 29. doi: 10.1002/anie.201302339. 10.1002/anie.201302339 PubMed 23630096