Skip to main content
Addgene
Open Menu

alpha cat in pET28-HisMBP-FLAGpp
(Plasmid #42615)

Print

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42615 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET28-HisMBP-FLAGpp
  • Backbone size w/o insert (bp) 7400
  • Total vector size (bp) 8600
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    catalytic domain of diacylglycerol kinase alpha
  • Alt name
    alpha cat
  • Alt name
    DGKA
  • Species
    S. scrofa
  • Insert Size (bp)
    1200
  • Mutation
    deleted amino acids 1-332
  • GenBank ID
    NM_214032.2
  • Entrez Gene
    DGKA (a.k.a. DAGK)
  • Tags / Fusion Proteins
    • hexahistidine (N terminal on backbone)
    • Pyrococcus furiosus maltose binding protein (N terminal on backbone)
    • FLAG tag (N terminal on backbone)
    • PreScission Protease site (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer aacgaaatcctccaagatcc
  • 3′ sequencing primer T7Term
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Ms. Tonya Gilbert, a PhD student in Professor Sean Taverna's lab (Pharmacology and Molecular Sciences, The Johns Hopkins University School of Medicine) generously provided the pET28-HisMBP-FLAGpp plasmid.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    alpha cat in pET28-HisMBP-FLAGpp was a gift from Daniel Raben (Addgene plasmid # 42615)
Related items: