CLPIT Cry2PHR-mCh-RhoA
(Plasmid
#42959)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 42959 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCLPIT
- Backbone size w/o insert (bp) 7821
- Total vector size (bp) 10656
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCry2PHR-mCherry-RhoA
-
SpeciesH. sapiens (human), A. thaliana (mustard weed)
-
Insert Size (bp)2835
-
Entrez GeneRHOA (a.k.a. ARH12, ARHA, EDFAOB, RHO12, RHOH12)
- Promoter Tet-Off promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site PmeI (not destroyed)
- 5′ sequencing primer AGACGCCATCCAACGCTGTTT
- 3′ sequencing primer AGAGCCTGGACCACTGATATCCTGTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CLPIT Cry2PHR-mCh-RhoA was a gift from David Schaffer (Addgene plasmid # 42959 ; http://n2t.net/addgene:42959 ; RRID:Addgene_42959) -
For your References section:
Optogenetic protein clustering and signaling activation in mammalian cells. Bugaj LJ, Choksi AT, Mesuda CK, Kane RS, Schaffer DV. Nat Methods. 2013 Feb 3. doi: 10.1038/nmeth.2360. 10.1038/nmeth.2360 PubMed 23377377