pCoofy26
(Plasmid
#44000)
-
Purpose(Empty Backbone)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44000 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET, pCoofy15
-
Backbone manufacturerNovagen
- Backbone size (bp) 7249
-
Modifications to backboneInsertion of Llp-ccdB
-
Vector typeBacterial Expression
- Promoter T7
-
Tags
/ Fusion Proteins
- NusA (N terminal on backbone)
- His10 (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DB3.1
-
Growth instructionsccdB Survival cells are NOT suitable for the unmodified plasmid containing the ccdB gene. The plasmid is provided in the recommended DB3.1 strain.
-
Copy numberLow Copy
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer 5' CGTTTGTACGCTGGAAGATCTCG 3'
- 3′ sequencing primer 5' GCTAGTTATTGCTCAGCGG 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCoofy26 was a gift from Sabine Suppmann (Addgene plasmid # 44000 ; http://n2t.net/addgene:44000 ; RRID:Addgene_44000) -
For your References section:
A new method to customize protein expression vectors for fast, efficient and background free parallel cloning. Scholz J, Besir H, Strasser C, Suppmann S. BMC Biotechnol. 2013 Feb 14;13(1):12. 10.1186/1472-6750-13-12 PubMed 23410102