Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

N118 nLV EF-1a-Gal-FKBPx1-HA-PGK-Blast
(Plasmid #44245)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 44245 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    N103
  • Backbone size w/o insert (bp) 8600
  • Vector type
    Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    FKBP
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    321
  • Entrez Gene
    FKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
  • Promoter EF-1a
  • Tags / Fusion Proteins
    • Gal4/DBD/aa1-147 (N terminal on insert)
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
  • 3′ sequencing primer gtggatgtggaatgtgtgcga
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    N118 nLV EF-1a-Gal-FKBPx1-HA-PGK-Blast was a gift from Jerry Crabtree (Addgene plasmid # 44245 ; http://n2t.net/addgene:44245 ; RRID:Addgene_44245)
  • For your References section:

    Dynamics and memory of heterochromatin in living cells. Hathaway NA, Bell O, Hodges C, Miller EL, Neel DS, Crabtree GR. Cell. 2012 Jun 22;149(7):1447-60. doi: 10.1016/j.cell.2012.03.052. Epub 2012 Jun 14. 10.1016/j.cell.2012.03.052 PubMed 22704655