pBAD/HisB-PAiRFP2
(Plasmid
#44271)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBAD/HisB
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4064
- Total vector size (bp) 4092
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePAiRFP2
-
Alt namePhotoactivatable iRFP2
-
SpeciesSynthetic
-
Insert Size (bp)1537
-
MutationK69R/R83K/G120D/A123T/M163L/Q168E/R220P/S243N/V244F/G269D/A276V/Y280C/V294A/H303F/H333R/I336L/D349R/M351I/A386V/G409D/L419I/T469S/A487T/E494G
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site AsuII (BstBI) (not destroyed)
- 5′ sequencing primer atgccatagcatttttatcc
- 3′ sequencing primer GAT TTA ATC TGT ATC AGG CTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD/HisB-PAiRFP2 was a gift from Vladislav Verkhusha (Addgene plasmid # 44271 ; http://n2t.net/addgene:44271 ; RRID:Addgene_44271) -
For your References section:
Far-red light photoactivatable near-infrared fluorescent proteins engineered from a bacterial phytochrome. Piatkevich KD, Subach FV, Verkhusha VV. Nat Commun. 2013 Jul 10;4:2153. doi: 10.1038/ncomms3153. 10.1038/ncomms3153 PubMed 23842578