pBAD/HisD-TagRFP675
(Plasmid
#44274)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44274 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD/HisD
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3993
- Total vector size (bp) 4017
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTagRFP675
-
SpeciesSynthetic
-
Insert Size (bp)708
-
MutationM41Q/F80W/S143N/L147M/S158N/D159Y/N173S
- Promoter pBAD
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer atgccatagcatttttatcc
- 3′ sequencing primer GAT TTA ATC TGT ATC AGG CTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD/HisD-TagRFP675 was a gift from Vladislav Verkhusha (Addgene plasmid # 44274 ; http://n2t.net/addgene:44274 ; RRID:Addgene_44274) -
For your References section:
Extended Stokes shift in fluorescent proteins: chromophore-protein interactions in a near-infrared TagRFP675 variant. Piatkevich KD, Malashkevich VN, Morozova KS, Nemkovich NA, Almo SC, Verkhusha VV. Sci Rep. 2013;3:1847. doi: 10.1038/srep01847. 10.1038/srep01847 PubMed 23677204