pTagRFP675-actin-C1
(Plasmid
#44277)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44277 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 5072
- Total vector size (bp) 5814
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagRFP675
-
SpeciesSynthetic
-
Insert Size (bp)742
-
MutationM41Q/F80W/S143N/L147M/S158N/D159Y/N173S
- Promoter CMV
-
Tag
/ Fusion Protein
- Actin (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer cggtaggcgtgtacggtgggag
- 3′ sequencing primer gttcagggggaggtgtgggagg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTagRFP675-actin-C1 was a gift from Vladislav Verkhusha (Addgene plasmid # 44277 ; http://n2t.net/addgene:44277 ; RRID:Addgene_44277) -
For your References section:
Extended Stokes shift in fluorescent proteins: chromophore-protein interactions in a near-infrared TagRFP675 variant. Piatkevich KD, Malashkevich VN, Morozova KS, Nemkovich NA, Almo SC, Verkhusha VV. Sci Rep. 2013;3:1847. doi: 10.1038/srep01847. 10.1038/srep01847 PubMed 23677204