-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44445 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerGlontech
- Backbone size w/o insert (bp) 4733
- Total vector size (bp) 6061
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTFEB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1321
-
MutationDeleted amino acids 1-30; H32D
-
Entrez GeneTFEB (a.k.a. ALPHATFEB, BHLHE35, TCFEB)
-
Tag
/ Fusion Protein
- GFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAndrea Ballabio, TIGEM, Naples, Italy
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The first 30 amino acids of the TFEB insert (up to M31) were deleted. In order to create an optimal Kozak sequence at the new start site (M31), an additional mutation was introduced that changed the second amino acid from H to D (H32D mutation relative to the wild-type sequence).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGFP-N1-delta30-TFEB was a gift from Shawn Ferguson (Addgene plasmid # 44445 ; http://n2t.net/addgene:44445 ; RRID:Addgene_44445) -
For your References section:
The Transcription Factor TFEB Links mTORC1 Signaling to Transcriptional Control of Lysosome Homeostasis. Roczniak-Ferguson A, Petit CS, Froehlich F, Qian S, Ky J, Angarola B, Walther TC, Ferguson SM. Sci Signal. 2012 Jun 12;5(228):ra42. 10.1126/scisignal.2002790 PubMed 22692423