Skip to main content

pCRISPR::rpsL
(Plasmid #44505)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44505 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 44505-D50 50 μg of DNA in Tris buffer $495
DNA 44505-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pZE21-MCS1
  • Backbone size w/o insert (bp) 2254
  • Total vector size (bp) 2433
  • Vector type
    CRISPR ; E.coli

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRISPR::rpsL
  • Entrez Gene
    rpsL (a.k.a. b3342, ECK3329, asuB, strA)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence aaaaaaccgaactccgcgctgcgtaaagta

This plasmid is also known as pDB130.

For more information on Marraffini Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/marraffini/

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCRISPR::rpsL was a gift from Luciano Marraffini (Addgene plasmid # 44505 ; http://n2t.net/addgene:44505 ; RRID:Addgene_44505)
  • For your References section:

    RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508. 10.1038/nbt.2508 PubMed 23360965