-
PurposeA crRNA expression plasmid specific to the rpsL allele.
-
Depositing Lab
-
Depositing OrganizationRockefeller University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44505 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 44505-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 44505-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepZE21-MCS1
- Backbone size w/o insert (bp) 2254
- Total vector size (bp) 2433
-
Vector typeCRISPR ; E.coli
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRISPR::rpsL
-
Entrez GenerpsL (a.k.a. b3342, ECK3329, asuB, strA)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence aaaaaaccgaactccgcgctgcgtaaagta
This plasmid is also known as pDB130.
For more information on Marraffini Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/marraffini/
DNA (Catalog # 44505-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 44505-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCRISPR::rpsL was a gift from Luciano Marraffini (Addgene plasmid # 44505 ; http://n2t.net/addgene:44505 ; RRID:Addgene_44505) -
For your References section:
RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Jiang W, Bikard D, Cox D, Zhang F, Marraffini LA. Nat Biotechnol. 2013 Jan 29. doi: 10.1038/nbt.2508. 10.1038/nbt.2508 PubMed 23360965