pFX06
(Plasmid
#44532)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 44532 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepRM200
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHHT2
-
SpeciesS. cerevisiae (budding yeast)
-
MutationK56R
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (unknown if destroyed)
- 3′ cloning site Sal I (unknown if destroyed)
- 5′ sequencing primer CGCGTTGCTTCTTGTGACCGCAGTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFX06 was a gift from Michael Grunstein (Addgene plasmid # 44532 ; http://n2t.net/addgene:44532 ; RRID:Addgene_44532) -
For your References section:
Sir2 deacetylates histone H3 lysine 56 to regulate telomeric heterochromatin structure in yeast. Xu F, Zhang Q, Zhang K, Xie W, Grunstein M. Mol Cell. 2007 Sep 21;27(6):890-900. 10.1016/j.molcel.2007.07.021 PubMed 17889663