pUK499
(Plasmid
#44535)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44535 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTSB1-1
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHHF2
-
SpeciesS. cerevisiae (budding yeast)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH I (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer CCTACATCTTGTTCAAAAGAGTAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUK499 was a gift from Michael Grunstein (Addgene plasmid # 44535 ; http://n2t.net/addgene:44535 ; RRID:Addgene_44535) -
For your References section:
Effects of histone H4 depletion on the cell cycle and transcription of Saccharomyces cerevisiae. Kim UJ, Han M, Kayne P, Grunstein M. EMBO J. 1988 Jul;7(7):2211-9. PubMed 3046933