pGL4.75-KRAS LCS6m
(Plasmid #44571)

• Depositing Lab: Frank Slack
• Publication: KRASLCS6m (unpublished)

Backbone

• Vector backbone: pGL4.75
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 4281
• Total vector size (bp): 8181
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: KRAS 3'UTR
• Species: H. sapiens (human)
• Insert Size (bp): 3900
• Mutation: The T allele at LCS6 (let-7 complementary site 6) was changed to the G allele (rs61764370 T>G)
• GenBank ID: NM_004985.3
• Entrez Gene: KRAS (a.k.a. 'C-K-RAS, C-K-RAS, CFC2, K-RAS2A, K-RAS2B, K-RAS4A, K-RAS4B, K-Ras, K-Ras 2, KI-RAS, KRAS1, KRAS2, NS, NS3, OES, RALD, RASK2, c-Ki-ras, c-Ki-ras2)
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xba1 (destroyed during cloning)
• 3′ cloning site: xba1 (destroyed during cloning)
• 5′ sequencing primer: TGACACAGGGAGACTACATTTAATTC
• 3′ sequencing primer: GCCTGAACTAGTTCACAGACAAGG

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

A substitute for pGL3-KRAS LCS6m in Chin et al., 2008.