PRS415-Gal1pr-sctetR-FokI
(Plasmid
#44756)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44756 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonePRS415
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 8442
-
Modifications to backboneremoved NgoMIV-KpnI fragment by blunt end ligation
-
Vector typeYeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesctetR-FokI
-
SpeciesSynthetic
-
Insert Size (bp)1965
-
Entrez GenefokI (a.k.a. HCBAA847_2198)
- Promoter Gal1pr
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CTCTATACTTTAACGTCAAGGAG
- 3′ sequencing primer GAATGTAAGCGTGACATAAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PRS415-Gal1pr-sctetR-FokI was a gift from Narendra Maheshri (Addgene plasmid # 44756 ; http://n2t.net/addgene:44756 ; RRID:Addgene_44756) -
For your References section:
Harnessing mutagenic homologous recombination for targeted mutagenesis in vivo by TaGTEAM. Finney-Manchester SP, Maheshri N. Nucleic Acids Res. 2013 Mar 7. 10.1093/nar/gkt150 PubMed 23470991