Skip to main content
Addgene

pBa.Kif5c 1-559.GFP
(Plasmid #45059)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 45059 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBa-eGFP
  • Backbone size w/o insert (bp) 6755
  • Total vector size (bp) 8410
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Kif5c
  • Alt name
    Kif5c560
  • Alt name
    kinesin family member 5C
  • Species
    R. norvegicus (rat)
  • Insert Size (bp)
    1676
  • Mutation
    motor domain aa1-559
  • GenBank ID
    NM_001107730.1
  • Entrez Gene
    Kif5c
  • Promoter Chicken Beta Actin
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
  • 3′ sequencing primer GTGGTTTGTCCAAACTCATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Kif 5c received from Bruce Schnapp, Oregon Health & Science University
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pBa vector is susceptable to recombination and should not be grown in fast growing bacteria or cloned using recombination.
XL 10-Gold, Stbl3, OmniMax2, DH5alpha, and XL 1-Blue are suitable growth strains.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBa.Kif5c 1-559.GFP was a gift from Gary Banker & Marvin Bentley (Addgene plasmid # 45059 ; http://n2t.net/addgene:45059 ; RRID:Addgene_45059)
  • For your References section:

    A change in the selective translocation of the Kinesin-1 motor domain marks the initial specification of the axon. Jacobson C, Schnapp B, Banker GA. Neuron. 2006 Mar 16;49(6):797-804. 10.1016/j.neuron.2006.02.005 PubMed 16543128