pThy1-Autobow
(Plasmid #45187)

• Depositing Lab: Joshua Sanes
• Depositing Organization: Harvard University
  Located in United States of America
• Publication: Cai et al Nat Methods. 2013 May 5;10(6):540-7. doi: 10.1038/nmeth.2450. Epub 2013 May 5.

Backbone

• Vector backbone: pUC18
• Total vector size (bp): 4800
• Vector type: linearized for transgenic mouse injection

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: pThy1-Autobow
• Species: jelly fish and coral fluorescent proteins
• Insert Size (bp): 4800
• Promoter: Thy1

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: TCTGAGTGGCAAAGGACCTTAGG
• 3′ sequencing primer: GACTTGGGGAGGGAGTCAGCTGACC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: cloned by Kim Cohen and Dawen Cai

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 45187-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 45187-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.