mpx:UtrCH-GFP
(Plasmid
#45247)
-
PurposeZebrafish Tol2 transgenesis for UtrCH-EGFP (calponin homology domain of utrophin fused to EGFP) expression under mpx promoter in neutrophils, labels actin filaments.
-
Depositing Lab
-
Depositing OrganizationUniversity of Wisconsin, Madison
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 45247 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 45247-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 45247-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonetol2:mpx-gfp
- Backbone size w/o insert (bp) 12500
- Total vector size (bp) 13442
-
Modifications to backboneinserted utrophin
-
Vector typezebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameutrophin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)700
-
Mutationcontains amino acids 1-261 of NP_009055.2; Q236R
-
Entrez GeneUTRN (a.k.a. DMDL, DRP, DRP1)
- Promoter mpx
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NcoI (not destroyed)
- 5′ sequencing primer TAGGGATCCGGTAGGCGTGTA
- 3′ sequencing primer tgaacagctcctcgccctt
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe original plasmid is a generous gift from W. Bement(Burkel et al., 2007)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 45247-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 45247-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mpx:UtrCH-GFP was a gift from Anna Huttenlocher (Addgene plasmid # 45247 ; http://n2t.net/addgene:45247 ; RRID:Addgene_45247) -
For your References section:
Differential regulation of protrusion and polarity by PI3K during neutrophil motility in live zebrafish. Yoo SK, Deng Q, Cavnar PJ, Wu YI, Hahn KM, Huttenlocher A. Dev Cell. 2010 Feb 16. 18(2):226-36. 10.1016/j.devcel.2009.11.015 PubMed 20159593