Tg (mpx:mCherry-2A-Rac2D57N)
(Plasmid
#58934)
-
Purposeexpresses dominant negative rac2 tagged with mcherry in neutrophils
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58934 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneTol2
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 13155
-
Modifications to backboneInserted mpx-mcherry-2a-Rac2D57N
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemcherry-2a-Rac2D57N
-
SpeciesD. rerio (zebrafish)
-
Insert Size (bp)1353
-
Mutationchanged Aspartate 57 to Asparagine
-
Entrez Generac2 (a.k.a. zgc:86686)
- Promoter mpx
-
Tag
/ Fusion Protein
- mcherry2a (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer Gtgaaagtacaagtacttagggaaaa
- 3′ sequencing primer gtgtggaattgtgagcggataac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tg (mpx:mCherry-2A-Rac2D57N) was a gift from Anna Huttenlocher (Addgene plasmid # 58934 ; http://n2t.net/addgene:58934 ; RRID:Addgene_58934) -
For your References section:
Dual roles for Rac2 in neutrophil motility and active retention in zebrafish hematopoietic tissue. Deng Q, Yoo SK, Cavnar PJ, Green JM, Huttenlocher A. Dev Cell. 2011 Oct 18;21(4):735-45. doi: 10.1016/j.devcel.2011.07.013. 10.1016/j.devcel.2011.07.013 PubMed 22014524