Skip to main content
Holiday Schedule: Addgene will be closed December 24 - December 31. Order processing and shipping will resume on January 3, 2022. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Tg (mpx:mCherry-2A-Rac2D57N)
(Plasmid #58934)


Item Catalog # Description Quantity Price (USD)
Plasmid 58934 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 13155
  • Modifications to backbone
    Inserted mpx-mcherry-2a-Rac2D57N

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
  • Mutation
    changed Aspartate 57 to Asparagine
  • Entrez Gene
    rac2 (a.k.a. zgc:86686)
  • Promoter mpx
  • Tag / Fusion Protein
    • mcherry2a (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer Gtgaaagtacaagtacttagggaaaa
  • 3′ sequencing primer gtgtggaattgtgagcggataac
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tg (mpx:mCherry-2A-Rac2D57N) was a gift from Anna Huttenlocher (Addgene plasmid # 58934 ; ; RRID:Addgene_58934)
  • For your References section:

    Dual roles for Rac2 in neutrophil motility and active retention in zebrafish hematopoietic tissue. Deng Q, Yoo SK, Cavnar PJ, Green JM, Huttenlocher A. Dev Cell. 2011 Oct 18;21(4):735-45. doi: 10.1016/j.devcel.2011.07.013. 10.1016/j.devcel.2011.07.013 PubMed 22014524