-
Purposeexpresses photoconvertible dendra in macrophages
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51462 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonetol2
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 6000
-
Modifications to backboneinserted mpeg promoter + dendra2
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namempeg-dendra
-
Insert Size (bp)2500
- Promoter mpeg1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer Gtgaaagtacaagtacttagggaaaa
- 3′ sequencing primer gtgtggaattgtgagcggataac (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Tol2-mpeg1-dendra2 was a gift from Anna Huttenlocher (Addgene plasmid # 51462 ; http://n2t.net/addgene:51462 ; RRID:Addgene_51462) -
For your References section:
Innate immune response to Streptococcus iniae infection in zebrafish larvae. Harvie EA, Green JM, Neely MN, Huttenlocher A. Infect Immun. 2013 Jan;81(1):110-21. doi: 10.1128/IAI.00642-12. Epub 2012 Oct 22. 10.1128/IAI.00642-12 PubMed 23090960