Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #51462)


Item Catalog # Description Quantity Price (USD)
Plasmid 51462 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 6000
  • Modifications to backbone
    inserted mpeg promoter + dendra2
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Insert Size (bp)
  • Promoter mpeg1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer Gtgaaagtacaagtacttagggaaaa
  • 3′ sequencing primer gtgtggaattgtgagcggataac
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tol2-mpeg1-dendra2 was a gift from Anna Huttenlocher (Addgene plasmid # 51462 ; ; RRID:Addgene_51462)
  • For your References section:

    Innate immune response to Streptococcus iniae infection in zebrafish larvae. Harvie EA, Green JM, Neely MN, Huttenlocher A. Infect Immun. 2013 Jan;81(1):110-21. doi: 10.1128/IAI.00642-12. Epub 2012 Oct 22. 10.1128/IAI.00642-12 PubMed 23090960