Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMP45-1
(Plasmid #45372)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 45372 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFLAG-CMV2
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 6300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MAVS
  • Species
    Macaca mulatta (Rhesus monkey)
  • Insert Size (bp)
    1626
  • GenBank ID
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BglII (not destroyed)
  • 5′ sequencing primer gacgcaaatgggcggtaggcgtg
  • 3′ sequencing primer gacaaggctggtgggcactggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMP45-1 was a gift from Harmit Malik (Addgene plasmid # 45372 ; http://n2t.net/addgene:45372 ; RRID:Addgene_45372)
  • For your References section:

    Convergent evolution of escape from hepaciviral antagonism in primates. Patel MR, Loo YM, Horner SM, Gale M Jr, Malik HS. PLoS Biol. 2012;10(3):e1001282. doi: 10.1371/journal.pbio.1001282. Epub 2012 Mar 13. 10.1371/journal.pbio.1001282 PubMed 22427742