TRS6E1b-luc(-732/-721) mutant 2
(Plasmid
#45385)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 45385 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL2 basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5700
-
Modifications to backboneE1bTATA inserted upstream of luciferase
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name6 copies of hPAI-1 promoter -732/-721 mutated at -730/-728
-
Alt nameTRS6 m2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)72
-
Mutationmutated at -730/-728 from aca to tgt
-
Tag
/ Fusion Protein
- luciferase
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer TGTATCTTATGGTACTGTAACTG from Promega
- 3′ sequencing primer CTTTATGTTTTTGGCGTCTTCCA from Promega (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TRS6E1b-luc(-732/-721) mutant 2 was a gift from Thomas Gelehrter (Addgene plasmid # 45385 ; http://n2t.net/addgene:45385 ; RRID:Addgene_45385) -
For your References section:
Smad4/DPC4 and Smad3 mediate transforming growth factor-beta (TGF-beta) signaling through direct binding to a novel TGF-beta-responsive element in the human plasminogen activator inhibitor-1 promoter. Song CZ, Siok TE, Gelehrter TD. J Biol Chem. 1998 Nov 6;273(45):29287-90. 10.1074/jbc.273.45.29287 PubMed 9792626
Map uploaded by the depositor.
